Need help with your Discussion

Get a timely done, PLAGIARISM-FREE paper
from our highly-qualified writers!

glass
pen
clip
papers
heaphones

write a primer

write a primer

write a primer

Description

design two new primers (one forward and one reverse) to amplify the GFP gene from the plasmid pGFPuv. A document with an example can be found below.

Important notes:

You must be able to digest the PCR product with the restriction enzyme PstI, so the palindrome must be in your primers or in the sequence between the primers.

Your primers should be between 15 and 25 base pairs and should only appear once in the pGFP sequence.

The Tm of both primers should be shown.  Please note, that restriction enzyme sites added onto the primer do not contribute to their Tm.

  • Both primers should be shown aligned against the amplified pGFPuv sequence and all elements should be labelled (refer to the example provided).   

Unformatted Attachment Preview

Name tudent # – Group #
Forward primer
5 ACGCCAAGCTTGCATGCCTGCAGGT Ò
5`ACGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGGTAGAAAAAATGAG
TAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATG
GGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAA
TTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGG
TGTTCAATGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGC
CCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCT
GAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGA
AGATGGAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCACACAATGTATACATCACGG
CAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACATTGAAGATGGATCC
GTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGA
CAACCATTACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGG
TCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAATAATGA
ATTCCAACTGAGCGCCGGTCGCTACCATTAC -3³ CGCGGCCAGCGATGGTAATGGACGTCATTA 5’everse primer
Green
Red
=
=
gene for GFP
PstI restriction enzyme site
Tm forward primer
Tm reverse primer
=
=
80 Ê66 Ê
Purchase answer to see full
attachment

User generated content is uploaded by users for the purposes of learning and should be used following Studypool’s honor code & terms of service.

Have a similar assignment? "Place an order for your assignment and have exceptional work written by our team of experts, guaranteeing you A results."

Order Solution Now

Our Service Charter


1. Professional & Expert Writers: Eminence Papers only hires the best. Our writers are specially selected and recruited, after which they undergo further training to perfect their skills for specialization purposes. Moreover, our writers are holders of masters and Ph.D. degrees. They have impressive academic records, besides being native English speakers.

2. Top Quality Papers: Our customers are always guaranteed of papers that exceed their expectations. All our writers have +5 years of experience. This implies that all papers are written by individuals who are experts in their fields. In addition, the quality team reviews all the papers before sending them to the customers.

3. Plagiarism-Free Papers: All papers provided by Eminence Papers are written from scratch. Appropriate referencing and citation of key information are followed. Plagiarism checkers are used by the Quality assurance team and our editors just to double-check that there are no instances of plagiarism.

4. Timely Delivery: Time wasted is equivalent to a failed dedication and commitment. Eminence Papers are known for the timely delivery of any pending customer orders. Customers are well informed of the progress of their papers to ensure they keep track of what the writer is providing before the final draft is sent for grading.

5. Affordable Prices: Our prices are fairly structured to fit in all groups. Any customer willing to place their assignments with us can do so at very affordable prices. In addition, our customers enjoy regular discounts and bonuses.

6. 24/7 Customer Support: At Eminence Papers, we have put in place a team of experts who answer all customer inquiries promptly. The best part is the ever-availability of the team. Customers can make inquiries anytime.

We Can Write It for You! Enjoy 20% OFF on This Order. Use Code SAVE20

Stuck with your Assignment?

Enjoy 20% OFF Today
Use code SAVE20